• Home
  • Listen
  • Buy Now
  • FAQ
  • Contact
  • More
    • Home
    • Listen
    • Buy Now
    • FAQ
    • Contact
  • Home
  • Listen
  • Buy Now
  • FAQ
  • Contact

Buy now on Rarible.com

What is Viromusic?

  Viromusic is an exciting new NFT audio collection of songs that are created by the virus itself! The songs are made using the genetic sequence inside the Coronavirus.  Using a technique called DNA Sonification, the melody in the songs is derived entirely from the viral sequence.  Every note in the melody is part of the step-by-step instructions the virus uses to make more copies of itself.

How it's made






For a video version, please visit: ViroMusic - How It's Made. 


First, the genetic code inside the virus is read using a DNA sequencer.  DNA uses four letters: A, T, C and G, strung together in a long list that looks like this:


 ATTAAAGGTTTATACCTTCCCAGGTAAC


In the Coronavirus, this list is over 30,000 letters long.  The code contains instructions for how to make more copies of the virus. 



Show More









Most living things use the same type of code.  It's broken up into sections of three letters called codons. There are only 21 different codons, each with its own signature.


We wrote software to assign a musical note to every codon.  For example:


GCT = A

CGT = A#

AAT = B

ATT = C










Our software then searches through the entire code of the virus to find sections that sound musical.


10,000 individual melodies are extracted in this way, by using a combination of code location and codon-to-note assignment.









The notes are turned into music using a Digital Audio Workstation, and become the melody of the song.


Other instruments are added as an accompaniment (for example cello, bass, drums). These extra instruments are played by humans ;)









Every song in the collection has a unique viral melody, making it one-of-a kind!


There are five song styles in the collection, ranging from slow, melodic songs to energetic rock.

Buy now on Rarible.com

Connect With Us

E-mail:

info@viromusic.io

Copyright © 2021  - All Rights Reserved.

Powered by GoDaddy

  • Privacy Policy
  • Terms and Conditions

This website uses cookies.

We use cookies to analyze website traffic and optimize your website experience. By accepting our use of cookies, your data will be aggregated with all other user data.

DeclineAccept